View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9580_low_14 (Length: 275)
Name: NF9580_low_14
Description: NF9580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9580_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 115 - 264
Target Start/End: Complemental strand, 23756593 - 23756444
Alignment:
| Q |
115 |
taatcacttacgttcttgtgagatgatacgataattatgacagtattattagagatgggtttcttctattagcnnnnnnntagaaaagatggatttcttc |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23756593 |
taatcacttatgttcttgtgagatgatacgataattatgacagtattattagagatgggtttcttctattagcaaaaaaatagaaaagatggatttcttc |
23756494 |
T |
|
| Q |
215 |
agcgtactaaaacatccaaccaaagtgtgattagtttgcagtataatcta |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23756493 |
agcgtactaaaacatccaaccaaagtgtgattagtttgcaatataatcta |
23756444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 16 - 167
Target Start/End: Complemental strand, 23755898 - 23755747
Alignment:
| Q |
16 |
aaaaggacttgcccatagtactaggag---aggtcatgttccaaacactatctttttgtcaaagaaaaatgataactaaacaccacaaaaattacgagat |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||| |||| |
|
|
| T |
23755898 |
aaaaggacttgcccatagtactaggagtcgaggtcatgttccaaacactatctttttgtcaaagagaaatgataactgaacac---aaaaattactagat |
23755802 |
T |
|
| Q |
113 |
gctaatcacttacgttcttgtgagatgatacgataattatgacagtattattaga |
167 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23755801 |
gctaatcacttccgttcttgtgagatgatacgataattatgacagtattattaga |
23755747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 23758180 - 23758098
Alignment:
| Q |
16 |
aaaaggacttgcccatagtactaggag---aggtcatgttccaaacactatctttttgtcaaagaaaaatgataactaaacac |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
23758180 |
aaaaggacttgcccatagtactaggagtcgaggtcatgttccaaacactatctttttgtgaaagagaaatgataactgaacac |
23758098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University