View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9580_low_17 (Length: 249)
Name: NF9580_low_17
Description: NF9580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9580_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 35318683 - 35318862
Alignment:
| Q |
1 |
aattctccaattagctcttaatgctcttcatgttgccgtaaacaaattcttatccggcaagaatttcttattaaggaccacaaagattgaatcgataaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35318683 |
aattctccaattagctcttaatgctcttcatgttgccgtagacaaattcttatccggtaagaatttcttattaaggaccacaaagattgaatcgataaaa |
35318782 |
T |
 |
| Q |
101 |
tattgaaatgatcaagaactcaaatcgctaatgataatcaagaacccacatataaagagtatttttgctcttgataaaga |
180 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35318783 |
tatcgaaatgatcaagaactcaaattgctaatgataatcgagaacccacatataaagagtatttttactcttgataaaga |
35318862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 246
Target Start/End: Original strand, 35318892 - 35318924
Alignment:
| Q |
214 |
tgtttattcacatatattcaagtataatctacc |
246 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
35318892 |
tgtttattcacatatattcaattataatctacc |
35318924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University