View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9580_low_20 (Length: 202)
Name: NF9580_low_20
Description: NF9580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9580_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 5755651 - 5755826
Alignment:
| Q |
13 |
ataattctactatcacttcttcaaatacataaataaataccataattcaaactttcttaggtatatatattgcaccattaggccttgttttctaacacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5755651 |
ataattctactatcacttcttcaaatacataaataaataccataattcaaacttccttaggtatatatattgcaccattaggccttgttttctaacacag |
5755750 |
T |
|
| Q |
113 |
cgagtttgtctaaatcacgagtttgtttcagataacaccgtgatatcaaacat--acacttaatatggtttcatag |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5755751 |
tgagtttgtctaaatcacgagtttgtttctgctaacaccgtgatatcaaacatacacacttaatatggtttcatag |
5755826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University