View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9581_low_25 (Length: 251)
Name: NF9581_low_25
Description: NF9581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9581_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 157 - 247
Target Start/End: Complemental strand, 11404312 - 11404222
Alignment:
| Q |
157 |
ccttaatttgtcacttttaatgaaaaattcggggttggtgttagttaaaaactagaggaaaaacttgaaagggagaaaagtataatctacc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
11404312 |
ccttaatttgtcacttttaatgaaaaattcggggttggtgttagttaaatactagataaaaaacttgaaaggaagaaaagtataatttacc |
11404222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University