View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9581_low_31 (Length: 240)
Name: NF9581_low_31
Description: NF9581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9581_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 56 - 223
Target Start/End: Original strand, 11404535 - 11404698
Alignment:
| Q |
56 |
tgtaatcaaacaactccaaatatctctttttcatttagcatcattcttttaagaaggtaaaagaaaatatttaatcactacaaactgataatcctaacta |
155 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
11404535 |
tgtaatcaaacagccccaaatatctctttttcatttagcatcattcttttaagaaggtaaaataaaatatttaat----acaaactgataatcctaacta |
11404630 |
T |
|
| Q |
156 |
acacaagaaatgtaatgatagaattcaagaagttctaacattcatattacgaaatcaaagatacaaca |
223 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11404631 |
acacaaaaaatgtaatgatagaattcaagaagttctaacattcatattacgaaatcaaagatataaca |
11404698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University