View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9581_low_33 (Length: 237)
Name: NF9581_low_33
Description: NF9581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9581_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 28290959 - 28290740
Alignment:
| Q |
1 |
tatgccaaattgctactagtattggtcggtactgcaaaatattcaaggtaagaaacaacactgcaaggtcaaactatcaacaaaagcaccacttttcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28290959 |
tatgccaaattgctactagtattggtcggtactgcaaaatattcaaggtaagaaacaacactgcaaggtcaaactatcaacaaaagcaccacttttcctc |
28290860 |
T |
 |
| Q |
101 |
cttttcgaatctacataaccgtcaatacatcgagggaaacaagttcaaaaaatcatcggtaactccacatacaaattatagttgccaatctatgggacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28290859 |
cttttcgaatctacataaccgtcaatacatcgagggaaacaagttcaaaaaatcaccgg-aactccacatacaaattatagttgccaatctatgggatca |
28290761 |
T |
 |
| Q |
201 |
aaccccttttgctccagaagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28290760 |
aaccccttttgctccagaagt |
28290740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 218
Target Start/End: Complemental strand, 28304994 - 28304951
Alignment:
| Q |
175 |
attatagttgccaatctatgggaccaaaccccttttgctccaga |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
28304994 |
attatagttgccaatctatgggaccaatgcccatttgctccaga |
28304951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 215
Target Start/End: Complemental strand, 19251410 - 19251356
Alignment:
| Q |
161 |
aactccacatacaaattatagttgccaatctatgggaccaaaccccttttgctcc |
215 |
Q |
| |
|
||||| ||||| | |||||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
19251410 |
aactctacatatagattatagttgccaaactatgggaccaatccccctttgctcc |
19251356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University