View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9581_low_41 (Length: 227)
Name: NF9581_low_41
Description: NF9581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9581_low_41 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 2755417 - 2755643
Alignment:
| Q |
1 |
cgccaaagggatcatcattatttgaaagagtaggagattgaggagaaggagaacgagaacgattggacaaagagttaacggtacaagatagatctttaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2755417 |
cgccaaagggatcatcattatttgaaagagtaggagattgaggagaaggagaacgagaacgattggacaaagagttaacgggacaagatagatctttaac |
2755516 |
T |
 |
| Q |
101 |
atcaataggtgggacgtcttgtatttgcttcggtggtggtggtcgaagctcgacaagatcaatgtcccatagaacccaatttgtcgtttttgtacgatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2755517 |
atcaataggtgggacgtcttgtatttgcttcggtggtggtggtcgaagctcgacaagatcaatgtcccatagaacccaatttgtcgtttttgtacgatat |
2755616 |
T |
 |
| Q |
201 |
ggaatatcatgggtgacggagtttctc |
227 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
2755617 |
ggaatatcatgcgtgacggagtttctc |
2755643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University