View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9582_high_7 (Length: 223)

Name: NF9582_high_7
Description: NF9582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9582_high_7
NF9582_high_7
[»] chr4 (1 HSPs)
chr4 (21-213)||(48145098-48145286)


Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 48145286 - 48145098
Alignment:
21 atgagctgccactctttcagtcgcatataa-----ctctgtctgaaatttcttataaaaattacatttagttaatttaacggaacaaaattgttgatact 115  Q
    ||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
48145286 atgagctgccactctttcagtcgcatataatataactctgtctgaaatttcttataaaaattacattta---------acggaacaaaattgttgatact 48145196  T
116 agcagtgttgttagagttagaccaatcgtttgaactgagtatcaactagtctgctggatgggtcaaccacgacttgttctccgtttctcaacaccaaa 213  Q
    || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||    
48145195 agtagtgttgttagagttagaccaatcggttgaactgagtatcaactagtctgctggatggttcaaccacgacttgttctccgtttctcatcaccaaa 48145098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University