View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9582_high_8 (Length: 202)
Name: NF9582_high_8
Description: NF9582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9582_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 42337143 - 42336973
Alignment:
| Q |
16 |
agagacgggacacttaacaaggaagtagagataatgaactaatattgttccaagagttttctctattcatttatcaacaatgatgtgtggtacgagacga |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42337143 |
agagacgggacacttaacaaggaagttgagataatgaactaatattgttccaagagttttctctattcatttatcaacaatgatgtgtggcgcgagacga |
42337044 |
T |
 |
| Q |
116 |
gacgaactatttacatttgttaatcatgcacaaccgctctgtgtattttggccacgtgttggctttgtatg |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42337043 |
gacgaattatttacatttgttaatcatgcacaaccgctctgtgtattttggccatgtgttggctttgtatg |
42336973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University