View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9582_low_13 (Length: 289)
Name: NF9582_low_13
Description: NF9582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9582_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 22957697 - 22957593
Alignment:
| Q |
18 |
agttgaagtttattagaagacaaattgaagagacttctttacaatttttaaatgtttaactcgtttttgcacatatataaatgactcaatagtttagact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22957697 |
agttgaagtttattagaagacaaattgaagagactt---tacaattttcaagtgtttaactcgtttttgcacatatataaatgactcaatagtttatact |
22957601 |
T |
|
| Q |
118 |
ggctctaa |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
22957600 |
ggctctaa |
22957593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 195 - 279
Target Start/End: Complemental strand, 22957523 - 22957439
Alignment:
| Q |
195 |
ggtagaacttgtagaacatattttgctaacctggactgtgttgtgacttaaactatcatgagatttatgaagtgtttcatctctg |
279 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22957523 |
ggtagaacttgtagtacatattttgctaacctagactgtgttgtgacttaaactatcatgagatttatgaagtgtttcatctctg |
22957439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University