View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9582_low_16 (Length: 254)
Name: NF9582_low_16
Description: NF9582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9582_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 215
Target Start/End: Original strand, 27445619 - 27445675
Alignment:
| Q |
159 |
agaccacatcgactaaggaaaaggatattgaaggtgtgctgtttgaaaaacccactc |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27445619 |
agaccacatcggctaaggaaaaggatattgaaggtgtgctgtttgaaaaacccactc |
27445675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University