View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9582_low_4 (Length: 392)
Name: NF9582_low_4
Description: NF9582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9582_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 4 - 207
Target Start/End: Original strand, 10034934 - 10035137
Alignment:
| Q |
4 |
ggatccgttatcttgccttggaaggattggtaggaggtagctgtttttcctttggtgtgtatgtgttggttcggtgatgtttggaggtgcagcggctggg |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10034934 |
ggatccgttatcatgccttggaaggattggtaggaggtagctgtttttcctttggtgtgtgtgtgttggttcggtgatgtttggaggtgcagcagctggg |
10035033 |
T |
 |
| Q |
104 |
gtgcgtgacctgttttgctgctgctgttgggagcctgctgtcatgctgcaggtttggtgttgctgggcatgtgcgcctgtttggattttaggcagtgagg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10035034 |
gtgcgtgacctgttttgctgctgctgttgggagcctgctgtcatgctgcaggtttggtgttgctgggcatgtgcgcctgtttggattttaggcagtgagg |
10035133 |
T |
 |
| Q |
204 |
ctgg |
207 |
Q |
| |
|
|||| |
|
|
| T |
10035134 |
ctgg |
10035137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 4 - 207
Target Start/End: Original strand, 10095303 - 10095506
Alignment:
| Q |
4 |
ggatccgttatcttgccttggaaggattggtaggaggtagctgtttttcctttggtgtgtatgtgttggttcggtgatgtttggaggtgcagcggctggg |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10095303 |
ggatccgttatcatgccttggaaggattggtaggaggtagctgtttttcctttggtgtgtgtgtgttggttcggtgatgtttggaggtgcagcagctggg |
10095402 |
T |
 |
| Q |
104 |
gtgcgtgacctgttttgctgctgctgttgggagcctgctgtcatgctgcaggtttggtgttgctgggcatgtgcgcctgtttggattttaggcagtgagg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10095403 |
gtgcgtgacctgttttgctgctgctgttgggagcctgctgtcatgctgcaggtttggtgttgctgggcatgtgcgcctgtttggattttaggcagtgagg |
10095502 |
T |
 |
| Q |
204 |
ctgg |
207 |
Q |
| |
|
|||| |
|
|
| T |
10095503 |
ctgg |
10095506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 252 - 382
Target Start/End: Original strand, 10035137 - 10035267
Alignment:
| Q |
252 |
gcctttgttgggttttgtggttggtttcttcttgggtggaggtgtcacgcatataggcggcaccttgttgtattgtttccctttccttgccgcgagtggt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10035137 |
gcctttgttgggttttgtggttggtttcttcttgggtggaggtgtcacgcatataggcggcaccttgttgtattgtttccctttccttgccgcgagtggt |
10035236 |
T |
 |
| Q |
352 |
tgtgcgtcttgcatatactcgtcgagaataa |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10035237 |
tgtgcgtcttgcatatactcgtcgagaataa |
10035267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 252 - 382
Target Start/End: Original strand, 10095506 - 10095636
Alignment:
| Q |
252 |
gcctttgttgggttttgtggttggtttcttcttgggtggaggtgtcacgcatataggcggcaccttgttgtattgtttccctttccttgccgcgagtggt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10095506 |
gcctttgttgggttttgtggttggtttcttcttgggtggaggtgtcacgcatataggcggcaccttgttgtattgtttcccttttcttgccgcgagtggt |
10095605 |
T |
 |
| Q |
352 |
tgtgcgtcttgcatatactcgtcgagaataa |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10095606 |
tgtgcgtcttgcatatactcgtcgagaataa |
10095636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 351 - 383
Target Start/End: Original strand, 6901999 - 6902031
Alignment:
| Q |
351 |
ttgtgcgtcttgcatatactcgtcgagaataat |
383 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
6901999 |
ttgtgcgtcttgcatatactcgacgagaataat |
6902031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University