View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9583_low_16 (Length: 295)
Name: NF9583_low_16
Description: NF9583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9583_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 37463741 - 37464013
Alignment:
| Q |
1 |
tatcgtggtttaaggtatcaacagggtgcacgtaggtacaaaagggaggcatacttctctgtgaatgatacaacaacgtccacacacatgatattcatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37463741 |
tatcgtggtttaaggtatcaacagggtgcacgtaggtacaaaagggaggcatacttctctctgaatgatacaacaacgtccacacgcatgatattcatgg |
37463840 |
T |
 |
| Q |
101 |
aagagggaggtctgttgtgcgacgggggagataagacaaacgcaaaattgattcgtgaatgcatagtgctcagatgaatggcaatgaacaatcatcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
37463841 |
aagagggaggtctgttgtgcgacgggggagattggacaaacgtaaaattgattcgtgaatgcaaagtgctcggatgaatggcaaggaacaatcatcaaat |
37463940 |
T |
 |
| Q |
201 |
gtggcagtgactacgatggcctccttttactctactaattttctagaaaaaatttcttatgttaagttacgaa |
273 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37463941 |
gtggcagtgactacaatggcctccttttactctactaattttctagaaaaaacttcttatgttaagttacgaa |
37464013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University