View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9583_low_18 (Length: 281)
Name: NF9583_low_18
Description: NF9583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9583_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 46236208 - 46236108
Alignment:
| Q |
18 |
attttctgcttcaaaatttgtacataatttgcagcctcacctatgtgatctgatactgaacgcttaccctaaaagcaaagaaagatgttgtgaaaactac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236208 |
attttctgcttcaaaatttgtacataatttgcagcctcacctatgtgatctgatactgaacgcttaccctaaaagcaaagaaagatgttgtgaaaactac |
46236109 |
T |
|
| Q |
118 |
g |
118 |
Q |
| |
|
| |
|
|
| T |
46236108 |
g |
46236108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 200 - 274
Target Start/End: Complemental strand, 46236027 - 46235953
Alignment:
| Q |
200 |
gaccttgatgagatcaaaaggaattgaagaacggagtgatgaacatagaatagacatttgcatcctcctttgctt |
274 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236027 |
gaccttgatgagatcaaaaggaagtgaagaacggagtgatgaacatagaatagacatttgcatcctcctttgctt |
46235953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University