View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9584_low_20 (Length: 270)
Name: NF9584_low_20
Description: NF9584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9584_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 22 - 260
Target Start/End: Original strand, 38356619 - 38356857
Alignment:
| Q |
22 |
acgagtacatttatcaaaagcacaacaagcattttaatttcattgcaaaatggccgcatcatccatggctctctcttcaccaaccttggctggcaagcca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38356619 |
acgagtacatttatcaaaagcacaacaagcattttaatttcattgcaaaatggccgcatcatccatggctctctcttcaccaaccttggctggcaagcca |
38356718 |
T |
|
| Q |
122 |
gtcaagctaaccccttcaagccaagaattgggagctgcaaggttcaccatgaggaaggctgctaccaccaagaaagtagcctcctcaggaagcccatggt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38356719 |
gtcaagctaaccccttcaagccaagaattgggagctgcaaggttcaccatgaggaaggctgctaccaccaagaaagtagcctcctcaggaagcccatggt |
38356818 |
T |
|
| Q |
222 |
acggcccagaccgtgttaagtacttaggcccattctctg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38356819 |
acggcccagaccgtgttaagtacttaggcccattctctg |
38356857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 258
Target Start/End: Original strand, 3569439 - 3569488
Alignment:
| Q |
209 |
ggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctc |
258 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
3569439 |
ggaagcccatggtacggtccagaccgtgtgaagtacttgggcccattctc |
3569488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 260
Target Start/End: Original strand, 3572486 - 3572537
Alignment:
| Q |
209 |
ggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctg |
260 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| || |||||||||| |
|
|
| T |
3572486 |
ggaagcccatggtacggtccagaccgtgtcaagtacttgggtccattctctg |
3572537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 258
Target Start/End: Original strand, 3563791 - 3563840
Alignment:
| Q |
209 |
ggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctc |
258 |
Q |
| |
|
||||| || |||||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
3563791 |
ggaagtccttggtacggtccagaccgtgtcaagtacttgggcccattctc |
3563840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University