View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9584_low_27 (Length: 241)
Name: NF9584_low_27
Description: NF9584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9584_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 48251686 - 48251478
Alignment:
| Q |
1 |
caactaaacctccaccaccatatagaagcactgtggacttgttttcaagcgcatcccactgataatgacaaatggatagtattacttctactttgttagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48251686 |
caactaaacctccaccaccatatagaagcactgtggacttgttttcaagcgcatcccactgataatgacaaatggttagtattacttctactttgttagt |
48251587 |
T |
 |
| Q |
101 |
aaagctgtaaaagacatcaatgctgccaaagagaagattagcaccaacacttatgtgtttggtgtccgacacaacac-----cgttgagtgtaattacat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
48251586 |
aaagctgtaaaagacatcaatgctgccaaagagaagattagcaccgacacttatgtgtttggtgtccgacacaacacaacaccgatgagtgtaattacat |
48251487 |
T |
 |
| Q |
196 |
taattgttt |
204 |
Q |
| |
|
||||||||| |
|
|
| T |
48251486 |
taattgttt |
48251478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University