View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9584_low_27 (Length: 241)

Name: NF9584_low_27
Description: NF9584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9584_low_27
NF9584_low_27
[»] chr7 (1 HSPs)
chr7 (1-204)||(48251478-48251686)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 48251686 - 48251478
Alignment:
1 caactaaacctccaccaccatatagaagcactgtggacttgttttcaagcgcatcccactgataatgacaaatggatagtattacttctactttgttagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
48251686 caactaaacctccaccaccatatagaagcactgtggacttgttttcaagcgcatcccactgataatgacaaatggttagtattacttctactttgttagt 48251587  T
101 aaagctgtaaaagacatcaatgctgccaaagagaagattagcaccaacacttatgtgtttggtgtccgacacaacac-----cgttgagtgtaattacat 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||     || |||||||||||||||    
48251586 aaagctgtaaaagacatcaatgctgccaaagagaagattagcaccgacacttatgtgtttggtgtccgacacaacacaacaccgatgagtgtaattacat 48251487  T
196 taattgttt 204  Q
    |||||||||    
48251486 taattgttt 48251478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University