View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9584_low_32 (Length: 238)
Name: NF9584_low_32
Description: NF9584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9584_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 24711854 - 24711634
Alignment:
| Q |
1 |
tgaaaatcttattttgatgtccttatccattcttccttggtggatnnnnnnnctttcttctaagttctaatagtagcagtagcaccgaaggataatgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24711854 |
tgaaaatcttattttgatgtccttatccattcttccttggtggataaaaaaactttcttctaagttctaatagtagcagtagcactgaaggataatgaaa |
24711755 |
T |
 |
| Q |
101 |
ttcaaagnnnnnnnnnnnnnnnnnnnatggaattatgaatttgtaacattatctctgatcaaagttgttacttaggcatttgaaccaagtgaccgaaacc |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24711754 |
ttcaaagttttttattttatttt---atggaattatgaatttgtaacattatctctgatcaaagttgttacttag-catttgaaccaagtgaccgaaacc |
24711659 |
T |
 |
| Q |
201 |
ttgaaccgtttttgggtcctttttg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
24711658 |
ttgaaccgtttttgggtcctttttg |
24711634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University