View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9586_low_23 (Length: 246)
Name: NF9586_low_23
Description: NF9586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9586_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 24180023 - 24180239
Alignment:
| Q |
12 |
tgttagggtaaactttggaattatatattgtcttgaatataattgcataatttcatatgccaaaggatgagtaatttgcttctgaattggaatacgtgtt |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
24180023 |
tgttagggtaaactttggaattatacattgtcttgaatttaattgcataatttgatatgccaaaggatgattaatttgcttatgaattggaatacgtgtt |
24180122 |
T |
|
| Q |
112 |
agaaatttaaaataggtgttgctactacccaacttgtgcacaatagttaataacttggttgtgtggtagaggtagatgatgacgattttggctagaagat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24180123 |
agaaatttaaaataggtgttgctactacccaacttgtgcacaatagttaataacttggttgtggggtagaggtagatgatgacgattttggctagaagat |
24180222 |
T |
|
| Q |
212 |
ttttggatgaggttggt |
228 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
24180223 |
ttttggacgaggttggt |
24180239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 24119965 - 24120054
Alignment:
| Q |
128 |
tgttgctactacccaacttgtgcac-aatagttaataacttggttgtgtggtagaggtagatgatgacgattttggctagaagatttttg |
216 |
Q |
| |
|
||||| |||||||| |||||||||| |||||| ||| |||||||| |||| |||||||| ||||| | ||||||| | |||||||||| |
|
|
| T |
24119965 |
tgttgttactaccccacttgtgcacaaatagtcaattacttggttttgtgtcagaggtaggtgatgccaattttggtttaaagatttttg |
24120054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University