View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9586_low_26 (Length: 242)
Name: NF9586_low_26
Description: NF9586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9586_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 19 - 163
Target Start/End: Original strand, 45376711 - 45376852
Alignment:
| Q |
19 |
agcttaagaaggataattcacggtggtggtggttttccattactataaataataataattagcggtgtagagagaggagagaaagtgctagggatttagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45376711 |
agcttaagaaggataattcacggtggtggtggttttccattactataaata---ataattagcggtgtagaaagaggagagaaagtgctagggatttagc |
45376807 |
T |
 |
| Q |
119 |
aatgacgtggtagttaagcttggaaattaatcacccttcttcaac |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45376808 |
aatgacgtggtagttaagcttggaaattaatcacccttcttcaac |
45376852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 242
Target Start/End: Original strand, 45376891 - 45376926
Alignment:
| Q |
207 |
gaagcgcacgtcctcctccctctttggaccttaagc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45376891 |
gaagcgcacgtcctcctccctctttggaccttaagc |
45376926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University