View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9586_low_28 (Length: 239)
Name: NF9586_low_28
Description: NF9586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9586_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 15156096 - 15156318
Alignment:
| Q |
1 |
agactatggaagacctaaaacttgcattcatattattttagtaaccccactaatttttcaatatctttctgtagtctctctacatggttggaacagattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15156096 |
agactatggaagacctaaaacttgcattcatattattttagtaaccccactaatttttcaatatctttctatagtctctctacatggttggaacagattt |
15156195 |
T |
|
| Q |
101 |
tcagtctctttccatgtgtgtgttcattatcactatcatcaaatattgcctacccaccaagtccgtacaatcccccattatttctatgattggttataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15156196 |
tcagtctctttccatgtgtgtgttcattatcactatcatcaaatattgcctacccaccaagtccgtacaatcccccattatttctatgattggttataaa |
15156295 |
T |
|
| Q |
201 |
atcttccacgataaccacaaatc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15156296 |
atcttccacgataaccacaaatc |
15156318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University