View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9586_low_41 (Length: 218)
Name: NF9586_low_41
Description: NF9586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9586_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 29937854 - 29937666
Alignment:
| Q |
15 |
ataatactggtattggagtagta-gttagttgatactaataaaattaagagatgactcttgaccaatgtcaccatggcagaaattaacaagcttctttta |
113 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29937854 |
ataatactagtattggagtagtaagttagttgatactaataaattgaagagatgactcttgaccaatgtcaccatggcagaaattaacaagcttctttta |
29937755 |
T |
 |
| Q |
114 |
ttgatttcttcgtccaaataatactatacaataatattctcaacaccttccacaggttggttattatgctactagtactatatatatat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29937754 |
ttgatttcttcgtccaaataatactatacaataatattctcaacaccttccacaggttggttattatgctactagtactatatatatat |
29937666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University