View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9587_high_12 (Length: 202)
Name: NF9587_high_12
Description: NF9587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9587_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 12 - 188
Target Start/End: Original strand, 45853255 - 45853431
Alignment:
| Q |
12 |
tttggtgttgtagaagaggtgaagttgttaccgtgttctcatcgatatcatggagattgcataatgccttggttggggattaggaatacttgtcctgttt |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45853255 |
tttgctgttgtagaagaggtgaagttgttgccgtgttctcatcgatatcatggtgattgcataatgccttggttggggattaggaatacttgtcctgttt |
45853354 |
T |
|
| Q |
112 |
gtcgctgtgagtttcctactgatgatgctgattatgaacgtaggaaagctccaatgttggctcggagcgcttgatgt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45853355 |
gtcgctgtgagtttcctactgatgatgctgattatgaacgtaggaaagctccaatgttggcccggagcgcttgatgt |
45853431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 148
Target Start/End: Original strand, 29164904 - 29164952
Alignment:
| Q |
100 |
cttgtcctgtttgtcgctgtgagtttcctactgatgatgctgattatga |
148 |
Q |
| |
|
|||||||||||||||| | |||||| ||||| |||||| |||||||||| |
|
|
| T |
29164904 |
cttgtcctgtttgtcgttttgagttgcctacagatgatcctgattatga |
29164952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University