View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9587_high_7 (Length: 250)
Name: NF9587_high_7
Description: NF9587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9587_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 24712129 - 24712354
Alignment:
| Q |
1 |
ttctggagaaagctttacataatatgtttaatgtcaacataaccattcataatcagcggatggggtggtcgtgtataataaggactcggatctggtgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24712129 |
ttctggagaaagctttacataatatgtttaatgtcaacataaccattcataatcagcagatggggtggtcgtgtataataaggact-tgatctggtgttt |
24712227 |
T |
 |
| Q |
101 |
gaacattgatgaacgggagctgattaagtggggtggtagacgtttttataggtagggaggtggatgttttattggtggttttattggtgtttttgtgggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
24712228 |
gaacattgatgaacgggagctgattaagtggggtggtagacgttttt-taggtagggaggtggat------------gttttattggtgttgttgtgggt |
24712314 |
T |
 |
| Q |
201 |
ggtagtgagctcttggtgtttctgttgtaggctgcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24712315 |
ggtagtgagctcttggtgtttctgttgtaggctgcctttg |
24712354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 190 - 240
Target Start/End: Original strand, 31424023 - 31424073
Alignment:
| Q |
190 |
tttttgtgggtggtagtgagctcttggtgtttctgttgtaggctgcctttg |
240 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31424023 |
ttttggtggatggtagtgtactcttggtgtttctgttgtaggctgcctttg |
31424073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 31423970 - 31424031
Alignment:
| Q |
117 |
gagctgattaagtgggg-tggtagacgtttttataggtagggaggtggatgttttattggtgg |
178 |
Q |
| |
|
||||||||||||||||| |||| || ||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
31423970 |
gagctgattaagtgggggtggttgatgttgtt-taggtagggaggtggatgtttttttggtgg |
31424031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 59 - 232
Target Start/End: Complemental strand, 17820344 - 17820171
Alignment:
| Q |
59 |
gatggggtggtcgtgtataataaggactcggatctggtgtttgaacatt-gatgaacgggagctgattaagtggggtggtagacgtttttataggtaggg |
157 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| ||| ||||||| |||||||||||||| |||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
17820344 |
gatggggtggtcgtgtataataagaactcggatatggcgttggaacatttgatgaacgggagcttattatatggggtggtagacatttttttaggtaggg |
17820245 |
T |
 |
| Q |
158 |
aggtggatgttttattggtggttttattggtgtttttgtgggtggtagtgagctcttggtgtttctgttgtaggc |
232 |
Q |
| |
|
||||||||||| |||| |||| ||| || ||| |||| ||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
17820244 |
aggtggatgttatattagtgggttt-ttagtgattttatgggtggtagtgatctctcggtgtttcagttgtaggc |
17820171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 3679106 - 3679149
Alignment:
| Q |
188 |
tgtttttgtgggtggtagtgagctcttggtgtttctgttgtagg |
231 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
3679106 |
tgtttttgtgggtggtggtgagctattggtgtttctgttgtagg |
3679149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 239
Target Start/End: Complemental strand, 15817791 - 15817737
Alignment:
| Q |
185 |
tggtgtttttgtgggtggtagtgagctcttggtgtttctgttgtaggctgccttt |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||| || |||||| |
|
|
| T |
15817791 |
tggtgtttttgtgggtggtggtgagctcttggtgtttatgttgtaagccgccttt |
15817737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University