View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9587_high_9 (Length: 237)
Name: NF9587_high_9
Description: NF9587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9587_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 33431374 - 33431595
Alignment:
| Q |
1 |
taatgaccaaagaaaaatatatcccttcatatttaaagaaatttctttcaaaaaataaataaatgttagattaggttgaatcaccaatctcattgagagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
33431374 |
taatgaccaaagaaaaatatatccctccatatttaaagaaatttctttcaaaaaataaataaatgctagattaggttgaatcaccaatc--attgagagt |
33431471 |
T |
|
| Q |
101 |
tttgaaatttgtctata--agtataaccttatttttgaaacaaaaatttatgtataatctatcaacaagaaaatcataaatttgaatctaataatttgta |
198 |
Q |
| |
|
||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33431472 |
tttgaaatttgtctatataagtatagtctt--ttttgaaacaaaaatttatgtataatctatcaacaagaaaatcataaatttgaatctaataatttgta |
33431569 |
T |
|
| Q |
199 |
cgagtggaaggtcgaaccatatatgt |
224 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
33431570 |
cgagtggaaggtcgagccatatatgt |
33431595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University