View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9587_low_20 (Length: 233)
Name: NF9587_low_20
Description: NF9587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9587_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 15393686 - 15393457
Alignment:
| Q |
4 |
tctatctagctttttgaactgatgtttgagggctcctaacagaaaacaaaacattct-------gaagcaaaagtaaaacacttcactgggtgttgccat |
96 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| | |||| |
|
|
| T |
15393686 |
tctatctaactttttgaactgatgtttgagggctcctaacagaaaacaaaacatgctctttaatgaagcaaaagtaaaacacttcactgggtggttccat |
15393587 |
T |
|
| Q |
97 |
tcatcaacaagattttagctaaataaacaaattattcaacaaatgtccgtccttcccaccatactgccaccccgccgatcctcaacgacgccaaatcacc |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||| |||| || | | ||||||||||||||||||||||||||||| |
|
|
| T |
15393586 |
tcatcaacaagattttagctaagtaaacaaattatttaacaaatgtccgttcttcccaacataatgtctcaccgccgatcctcaacgacgccaaatcacc |
15393487 |
T |
|
| Q |
197 |
accgtgta---acagatatgtaactctctg |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
15393486 |
accgtgtaattacagatatgtaactctctg |
15393457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University