View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9587_low_21 (Length: 218)
Name: NF9587_low_21
Description: NF9587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9587_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 59 - 202
Target Start/End: Complemental strand, 5337166 - 5337026
Alignment:
| Q |
59 |
caatataacaaatcatttcttttttggtacaaatgaaaaatcattcttattacatgcaataatagccaacttaattatttaagcatgaattatgtgtgag |
158 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337166 |
caatataaaaaatcatttcttttttggtacaaatgaaaaatcattcttattacatgcaata---gccaacttaattatttaagcatgaattatgtgtgag |
5337070 |
T |
 |
| Q |
159 |
aaagtccatctagttatttccgtatctgtttgatagttggtagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337069 |
aaagtccatctagttatttccgtatctgtttgatagttggtagt |
5337026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 5337370 - 5337288
Alignment:
| Q |
1 |
atctgtttggtagcatatgtctttgcatacctcagtgtctatataaaacaatcatatccaatataacaaatcatttctttttt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
5337370 |
atctgtttggtagcatatgtctttgcatacctcagtgtatatataaaacaatcatgtccaatataacaaatcatttttttttt |
5337288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University