View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9587_low_3 (Length: 287)
Name: NF9587_low_3
Description: NF9587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9587_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 5337417 - 5337691
Alignment:
| Q |
1 |
tgtaggtgacattttttagcaggggaagcatttacaatactccatcctttattcaaattcaggttcaaaatcagattccaatcttcaagtttaaacattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337417 |
tgtaggtgacattttttagcaggggaagcatttacaatactccatcctttattcaaattcaggttcaaaatcagattccaatcttcaagtttaaacattc |
5337516 |
T |
|
| Q |
101 |
tgctattcatcaatcaatatactccaacggtggcagatgggaaaggttagtttcgttgacttcagcttatttactgtaac-nnnnnnncttcaagttttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5337517 |
tgctattcatcaatcaatatactccaacggtggcagatgggaaaggttagtttcgttgacttcagcttatttactgtaacttttttttcttcaagttttt |
5337616 |
T |
|
| Q |
200 |
cgctgacgctgattttaatattaaaattagaaaaacgacgaacctgctgcttcttcttcatcatcttctgcttct |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337617 |
cgctgacgctgattttaatattaaaattagaaaaacgacgaacctgctgcttcttcttcatcatcttctgcttct |
5337691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University