View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9588_high_4 (Length: 320)
Name: NF9588_high_4
Description: NF9588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9588_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 51689643 - 51689341
Alignment:
| Q |
19 |
attcctctgtaccgttgcatattttccgatcacctcactccggttcttgcttatcggtgtttggttaaagaagatgaaagagatgctcctagctttctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689643 |
attcctctgtaccgttgcatattttccgatcacctcactccggttcttgcttatcggtgtttggttaaagaagatgaaagagatgctcctagctttctct |
51689544 |
T |
 |
| Q |
119 |
ttgaatctgctgaacccggtcttcacatttctagcaccgtaagttacttcaattctatgaagcacaaacaccaga-----------cacattgacaccgg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51689543 |
ttgaatctgctgaacccggtcttcacatttctagcaccgtaagttacttcaattctatgaagcacaaacaccagacacaatactgacacattgacaccgg |
51689444 |
T |
 |
| Q |
208 |
acatgaaataattgaatgtaatcacgtgtgttcgttcgtatggacacgcgtgagaagcttcaatcgtaagtgtcggtgctaacgtcattgtttatcctct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51689443 |
acatgaaataattgaatgtaatcacgtgtgttccttcgtatggacacgcgtgagaagcttcaatcataagtgtcggtgctaacgtcattgtttatcctct |
51689344 |
T |
 |
| Q |
308 |
ctg |
310 |
Q |
| |
|
||| |
|
|
| T |
51689343 |
ctg |
51689341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University