View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9588_low_12 (Length: 292)
Name: NF9588_low_12
Description: NF9588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9588_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 29 - 284
Target Start/End: Original strand, 42227514 - 42227768
Alignment:
| Q |
29 |
tattcccatttgcttaacaatatagaaacaaatgaagaggcatactttgtgtaagttgttgtattgacttttgagcatatgatttggcaaccctttatag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227514 |
tattcccatttgcttaacaatatagaaacaaatgaagaggcatactttgtgtcagttggtgtat-gacttttgagcatatgatttggcaaccctttatag |
42227612 |
T |
 |
| Q |
129 |
aagatgagtactattttcatgctatgatgttgggtccaaactaattttgttgtatgagttcgaatatctcttgtgctccctttaataaaaagtttgctta |
228 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
42227613 |
aagatgagtacaattttcctgctatgatgttgggtccaaactaattttgttgtatgagttcgaatatctcttgtactccctttattaaaaagtttgctta |
42227712 |
T |
 |
| Q |
229 |
tcgaaaataactcatatttgtatagctccctcagtcacaacttccctttgcttctc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42227713 |
tcgaaaataactcatatttgtatagctccctcagtcacaacttccctttgtttctc |
42227768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University