View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9588_low_22 (Length: 206)
Name: NF9588_low_22
Description: NF9588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9588_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 11360338 - 11360510
Alignment:
| Q |
19 |
agattgtgtcggtgattaacaagctaatgtggacggcttgtgcgtgcacttgtggagcttttctcgcaatagcttttgtggttgttggaaaggaaagatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11360338 |
agattgtgtcggtgattaacaagctaatgtggacggcttgtgcgtgcacttgtggagcttttctcgcaatagcttttgtggttgttggaaaggaaagatg |
11360437 |
T |
|
| Q |
119 |
gatggctattactgtaactgttttgggaacaccgattctagttgggactctagcatacttgtgctactctgtg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11360438 |
gatggctattactgtaactgttttgggaacaccgattctagttgggactctagcatacttgtgctactttgtg |
11360510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 34 - 186
Target Start/End: Original strand, 44399512 - 44399664
Alignment:
| Q |
34 |
ttaacaagctaatgtggacggcttgtgcgtgcacttgtggagcttttctcgcaatagcttttgtggttgttggaaaggaaagatggatggctattactgt |
133 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||| || || |||||| | || |||||||||| ||||||||||||| ||| ||||||||||||||| | |
|
|
| T |
44399512 |
ttaacaagctaatgtgggctgcttgtgcttgcacgtgcggtgcttttttggcgatagcttttgaggttgttggaaagaaaaaatggatggctattaccat |
44399611 |
T |
|
| Q |
134 |
aactgttttgggaacaccgattctagttgggactctagcatacttgtgctact |
186 |
Q |
| |
|
||||| ||| || | ||| ||||||||||||||||| ||| | ||||||||| |
|
|
| T |
44399612 |
aactggtttagggataccaattctagttgggactctggcaagcatgtgctact |
44399664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University