View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9592_low_19 (Length: 332)
Name: NF9592_low_19
Description: NF9592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9592_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 2298557 - 2298357
Alignment:
| Q |
19 |
aaaacgcataaattgaaaacgctgacacaacaaatcagtttgaaggaacacacgaacagaaaaatgtgtgaaaaaatgttgaaattcataccttttgtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2298557 |
aaaacgcataaattgaaaacgctgacacaacaaatcagtttgaaggaacacatgaacagaaatatgtgtgaaaaaatgttgaaattcataccttttgtgt |
2298458 |
T |
 |
| Q |
119 |
gtatcataagcaattttcacatgaaaaaatgtttcacccaagtttatccctgtaattaaatcagagagaaaaagattatcttaagcaatcgtcacccgaa |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2298457 |
gtatcataagcaactttcacatgaaaaaatatttcacccaagcttatccctgtaattaaatcagagagaaaaagattatcttaagcaatcgtcacccgaa |
2298358 |
T |
 |
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
2298357 |
a |
2298357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University