View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9592_low_23 (Length: 320)
Name: NF9592_low_23
Description: NF9592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9592_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 104 - 266
Target Start/End: Complemental strand, 31849250 - 31849086
Alignment:
| Q |
104 |
tgaattttgcaggacgacacattaccaaagctgaattttattaatgccttgtaaagatacatacatcttgaagacaagaaaccatctttatttgctta-- |
201 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31849250 |
tgaattattcaggacgacacattaccaaagctgaattttattaatgccttgtaaagatacatacatcttgaagacaagaaaccatctttatttgcttagt |
31849151 |
T |
|
| Q |
202 |
gtgattctattcctatgctgagtcattggctatcttgactttcagaagattgaaatagattgtgg |
266 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31849150 |
gtgattctattcctatgcttagtcattggctatcttgactttcagaagattgaaatagattgtgg |
31849086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 31849322 - 31849250
Alignment:
| Q |
1 |
gactgacattattttgtagcttcatgtttttcaataaaaatacatataaactttttctttgggtgaatatcat |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31849322 |
gactgacattattttgtagcttcatgtttttcaataaaaatacatataaactttttcattgggtgaatatcat |
31849250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 5 - 133
Target Start/End: Complemental strand, 11469319 - 11469191
Alignment:
| Q |
5 |
gacattattttgtagcttcatgtttttcaataaaaatacatataaactttttctttgggtgaatatcattttatgataacatgaattattcaatcaagct |
104 |
Q |
| |
|
||||| ||| |||| ||| || ||||||| |||||||||| | | ||||||||||||||| ||||||||||| |||||||| || ||||| ||||||||| |
|
|
| T |
11469319 |
gacataattctgtaacttgatttttttcagtaaaaatacaaacacactttttctttgggtcaatatcattttttgataacacgagttattaaatcaagct |
11469220 |
T |
|
| Q |
105 |
gaattttgcaggacgacacattaccaaag |
133 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |
|
|
| T |
11469219 |
gaattttgcaggaggacgcattaccaaag |
11469191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University