View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9592_low_37 (Length: 248)
Name: NF9592_low_37
Description: NF9592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9592_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 37337922 - 37338138
Alignment:
| Q |
13 |
caaaggaagaaaagagaaaggttgtgaagaaggttaggcataatagggttttggagttagccatagtgatatatttgtgaataggtgaagtaagtattat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37337922 |
caaaggaagaaaagagaaaggttgtgaagaaggttaggcataatagggttttggagttagccatagtgatatatttgtgaataggtgaagttagtattat |
37338021 |
T |
 |
| Q |
113 |
tggctaggttgtaatttgttagtgatgcataattcaaaggagaaaaaggattgtatttatagacggttgggactatgaaaagtatttggactttaggaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37338022 |
tggctaggttgtaatttgttagtgatgcataattgaaaggagaaaaaggattgtatttatagacggttgggactatgaaaagtatttggactttaggaga |
37338121 |
T |
 |
| Q |
213 |
gtgacctcataatatat |
229 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
37338122 |
gtgacctcatactatat |
37338138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University