View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9592_low_40 (Length: 242)
Name: NF9592_low_40
Description: NF9592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9592_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 4759957 - 4759742
Alignment:
| Q |
9 |
gagaagcatagggaggaggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggaga |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759957 |
gagaagcataaggaggaggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggaga |
4759858 |
T |
 |
| Q |
109 |
tagctgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759857 |
tagctgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggc |
4759758 |
T |
 |
| Q |
209 |
gtcgcaggtggttagt |
224 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
4759757 |
gtcacaggtggttagt |
4759742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 69 - 198
Target Start/End: Complemental strand, 26982283 - 26982154
Alignment:
| Q |
69 |
gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataa |
168 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||| ||| |||||||| ||||| | | | |||| ||||||||||||| ||||||||||| | |
|
|
| T |
26982283 |
gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaagatattgagatgctggctaaacaagatgttaaggtcagaaagttgatga |
26982184 |
T |
 |
| Q |
169 |
cagaacttggagtggtgccggttttggtat |
198 |
Q |
| |
|
| |||||| | |||||||| || ||||||| |
|
|
| T |
26982183 |
ctgaacttcgggtggtgcctgtattggtat |
26982154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 121
Target Start/End: Original strand, 26999135 - 26999187
Alignment:
| Q |
69 |
gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaaga |
121 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||| ||| |||||||| |
|
|
| T |
26999135 |
gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaaga |
26999187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University