View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9592_low_50 (Length: 237)
Name: NF9592_low_50
Description: NF9592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9592_low_50 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 35 - 223
Target Start/End: Original strand, 4328862 - 4329050
Alignment:
| Q |
35 |
cttagtaggttaacaacacatgaaaatgttagtgttgaaattggtgtctttgatcgttgtgtctatatttaaaatatgtgaaagttgtagtagatnnnnn |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4328862 |
cttagtaggttaacaacacatgaaaatgttaatgttgaaattggtgtctttgatctttgtgtctatatttaaagtatgtgaaagttgtagtagataaaaa |
4328961 |
T |
|
| Q |
135 |
nnnnnnnnnnnnnnnntatgagcacatatgatacaaataaaatgtctatattttgatggctcaagtaacacaactattcatgatcatta |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328962 |
gtaaaaaagaaataaatatgaacacatatgatacaaataaaatgtctatattttgatggctcaagtaacacaactattcatgatcatta |
4329050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University