View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9593_high_1 (Length: 239)
Name: NF9593_high_1
Description: NF9593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9593_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 33 - 223
Target Start/End: Complemental strand, 51848652 - 51848462
Alignment:
| Q |
33 |
tgatttgagcaaaatagctcggttaatccgggacaaatggagtaaaacacaatcataagggagactcccataagattcaatgcggaaaatatcttgaaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51848652 |
tgatttgagcaaaatagctcggttaatccgggacgaatggagtaaaacacaatcataagggagactcccataagattcaatgcggaaaatatcttgaaaa |
51848553 |
T |
|
| Q |
133 |
tacgatgtatcggatttgaggtcaagatattggtaaaaactatgccacacagaataatgttccctcttgtctttgcaaataagtttctttt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51848552 |
tacgatgtatcggatttgaggtcaaaatattggtaaaaactatgccacacagaataatgttccctcttgtctttgcaaataagtctctttt |
51848462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University