View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9593_low_5 (Length: 259)
Name: NF9593_low_5
Description: NF9593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9593_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 89 - 163
Target Start/End: Original strand, 25628507 - 25628581
Alignment:
| Q |
89 |
atcacttttgctttaagtcatattctagaaccaaacacacataacttgctatttcctacaagcagtattaacttc |
163 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25628507 |
atcacttttgcttttagtcatcttctaaaaccaaacacacatgacttgctatttcctacaagcagtattaacttc |
25628581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 25628446 - 25628506
Alignment:
| Q |
1 |
atgatatatttttgttgagatgaggatgataaaataattcttttcttaaatttgatagttt |
61 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
25628446 |
atgatatattttggttgagatgaggatgatagaataattcatttcttaaatttgatagttt |
25628506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 119
Target Start/End: Original strand, 25636448 - 25636488
Alignment:
| Q |
79 |
tgacaatcaaatcacttttgctttaagtcatattctagaac |
119 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
25636448 |
tgacaatcaaatcactgttgcttttagtcatattctagaac |
25636488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University