View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9593_low_7 (Length: 239)
Name: NF9593_low_7
Description: NF9593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9593_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 5 - 162
Target Start/End: Complemental strand, 39088491 - 39088334
Alignment:
| Q |
5 |
cagatgaacgagtttaaatctaccccaggactttcatcatcagcacctctaaatatgaaccgagatattcattgtaaaagagctgatgattcagaacccc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088491 |
cagatgaacgagtttaaatctaccccaggactttcatcatcagcacctctaaatatgaaccgagatattcattgtaaaagagctgatgattcagaacccc |
39088392 |
T |
|
| Q |
105 |
gagtctccttaggtacacgttatgtttcatgcttaatttttgacatacaaaatgtagt |
162 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088391 |
gaatctccttaggtacgcgttatgtttcatgcttaatttttgacatacaaaatgtagt |
39088334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University