View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9593_low_9 (Length: 235)

Name: NF9593_low_9
Description: NF9593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9593_low_9
NF9593_low_9
[»] chr7 (1 HSPs)
chr7 (1-173)||(39088565-39088737)


Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 39088737 - 39088565
Alignment:
1 tgtaaagcatgtggcacatattggattggatggtcctactgaaaatcccccaacctgggtaactctcttaatatattactcaaccttgttaaagattaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39088737 tgtaaagcatgtggcacatattggattggatggtcctactgaaaatcccccaacctgggtaactctcttaatatattactcaaccttgttaaagattaat 39088638  T
101 taactacttgaaccaaaaaagattaattagctacttaattattttttgtttctttagtgaacagtaaaaatat 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39088637 taactacttgaaccaaaaaagattaattagctacttaattattttttgtttctttagtgaacagtaaaaatat 39088565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University