View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9594_7 (Length: 402)
Name: NF9594_7
Description: NF9594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9594_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 24 - 373
Target Start/End: Complemental strand, 38720551 - 38720202
Alignment:
| Q |
24 |
atcatcagccaattgttgctgcaagaaacatatgttttcatctgtccacaattctgaatcaccaaaaacattgctctgttcaaattcttggatgtttgag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38720551 |
atcatcagccaattgttgctgcaagaaacatatgttttcatctgtccacaattctgaatcaccaaaaacattgctctgttcaaattcttggatgtttgag |
38720452 |
T |
|
| Q |
124 |
tctaaacagttccagtcctgccacgtggatcccagttctgcacaatccattaaattgtaagatacgtttgattctatttgaacttcaacccctgacgagt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38720451 |
tctaaacagttccagtcctgccacgtggatcccagttctgcacaatccattaaattgtaagatacgtttgattctacttgaacttcaacccctgacgagt |
38720352 |
T |
|
| Q |
224 |
acgatgaaacctcagactgcaacattggaggatttgcatttgccccacaagtttcactatgagctttagtattgttgcaagtggtgatttgtccgtggct |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38720351 |
acgatgaaacctcagactgcaacattggaggatttgcatttgccccacaagtttcactatgagctttagtatttttgcaagtggtgatttgtccgtggct |
38720252 |
T |
|
| Q |
324 |
ataggaattagtatctgcagttgcactagaagattggattctctcaataa |
373 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
38720251 |
ataggaattagtatctgcagttgcaccagaagattggattctctcgataa |
38720202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 65
Target Start/End: Original strand, 5080349 - 5080381
Alignment:
| Q |
33 |
caattgttgctgcaagaaacatatgttttcatc |
65 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
5080349 |
caattgatgctgcaagaaacatatgttttcatc |
5080381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University