View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_high_12 (Length: 372)
Name: NF9595A_high_12
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_high_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 372
Target Start/End: Complemental strand, 36173216 - 36172859
Alignment:
| Q |
19 |
acatcagacacccactaaacgtagttatcttttttggcgtaacattcagtttgataacaataaagtgtacttcagtaattgcagtaataaaacaatagaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36173216 |
acatcagacacccactaaacgtagttatcttttttggcgcaacattcagtttgataacaataaagtgtacttcagtaattccagtaataaaacaatagaa |
36173117 |
T |
 |
| Q |
119 |
tgtgcttctgtnnnnnnnnnnnnnnnnc----ggagtgcactatttttcactcaggctctagaactagggaggctgaatggaataatcaggacggtttct |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
36173116 |
tgtgcttctgtaaaaaaaaaaaaaaaaaaaatggagtgcactatttttcactcaggctctagaacttgggaggctgaatggaataatcgggacggtttct |
36173017 |
T |
 |
| Q |
215 |
caatccgccctatccatgctcagttctgtcaaaatacaccatcagaatggtaaacccctgcgtcgttgagggggcagaaggagaaattatcatgaatcag |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36173016 |
caatccgccctatccatgctcagttctgtcaaaatacactatcagaatggtaaacccctgcgtcgttgagggggcagaaggagaaattatcatgaatcag |
36172917 |
T |
 |
| Q |
315 |
tcatgctgctggctttatttgtacttaactttgttgggcctaatcttctaattataaa |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36172916 |
tcatgctgctggctttatttgtacttaactttgttgggcctaatcttctaattataaa |
36172859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University