View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_high_29 (Length: 286)
Name: NF9595A_high_29
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 57 - 193
Target Start/End: Original strand, 15827214 - 15827348
Alignment:
| Q |
57 |
tttaggtgatctatgattgcatttgagataagactatacctttttacttgacacttgatatgcctcaatacttctgctgatagacaagctagactattgt |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15827214 |
tttaggtgatctatgattgcatt-gagataagactatacctttttacttgacacctgatatgcctcaatacttctgctgatagacaagctagactcttgt |
15827312 |
T |
 |
| Q |
157 |
gatttcttcatgaaattgttaaagcatatgagtcaag |
193 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15827313 |
gatttcttcatgaaattgtt-aagcatatgagtcaag |
15827348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 186 - 286
Target Start/End: Original strand, 15827495 - 15827595
Alignment:
| Q |
186 |
gagtcaagtgtatggtttctctcataaaaaatttcattttgaacattgggatatgactcgcaagtggaatttcttatgatataaccaacattttgtattt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15827495 |
gagtcaagtgtatggtttctctcataaaaaatttcattttgaacattgggatatgactcgcaagtggaatttctcatgatataaccaacattttgtattt |
15827594 |
T |
 |
| Q |
286 |
t |
286 |
Q |
| |
|
| |
|
|
| T |
15827595 |
t |
15827595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 5600674 - 5600618
Alignment:
| Q |
48 |
tcttctctttttaggtgatctatgattgcatttgagataagactatacctttttactt |
105 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| ||||| || ||||||||| |
|
|
| T |
5600674 |
tcttctctttttaggtgatctatgattaca-ttgagatgagactctatgtttttactt |
5600618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University