View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_102 (Length: 306)
Name: NF9595A_low_102
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_102 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 6 - 297
Target Start/End: Complemental strand, 4164938 - 4164649
Alignment:
| Q |
6 |
aactttatttctcactttcattcaatgaacattgcaaactgctggaatagcagctcctttataagccttgcaaacatagtctgtaaaattttcatagtcc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4164938 |
aactttatttctcactttcattcaatgaacattgcaaactgctggaatagcagcgcctttataagccttgcaaacatagtctgtaaaattttcatagtcc |
4164839 |
T |
 |
| Q |
106 |
tgaaattaacatcacaaacaataatcttgatgagta-ttttggaaactagaccaattgtgtgtgtgtgtgagttattgnnnnnnnnnnnnnnggagaa-a |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| || || | |
|
|
| T |
4164838 |
tgaaattaacatcacaaacaataatcttgatgagtatttttggaaactagaccaat----tgtgtgtgtgagttattgggaaaaaaaaaaggagaaaaga |
4164743 |
T |
 |
| Q |
204 |
agacaaactttttcaataggttgattgttcaccaccacccatggcacaaaagaatgaggtggatctagttttgctgtttcatcaatatattttt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4164742 |
agacaaactttttcaataggttgattgttcaccaccacccatggcacaaaagaatgaggtggatctagttttgctgtttcatcaatatattttt |
4164649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University