View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_105 (Length: 303)
Name: NF9595A_low_105
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_105 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 74 - 179
Target Start/End: Original strand, 45212396 - 45212497
Alignment:
| Q |
74 |
tttaatcataaagctagaatatgggtactgtgattgactcccattttttagccctcactgccataatcacagtaagtacatattctcaattctcaattcc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
45212396 |
tttaatcataaagctagaatatgggtactgtgattgactcccattttttagccctcactgccataatcaccgtaag----tattctcaattctcaattcc |
45212491 |
T |
|
| Q |
174 |
aattcc |
179 |
Q |
| |
|
|||||| |
|
|
| T |
45212492 |
aattcc |
45212497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 215 - 295
Target Start/End: Original strand, 45212542 - 45212622
Alignment:
| Q |
215 |
atcaatatcaatttgcagtttgcctatcaacttatgtttttcatcatcaccgctcttctcaaattcgacaaggtctctgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45212542 |
atcaatatcaatttgcagtttgcctatcaacttctgtttttcatcatcaccgctcttctcaaattcgacaaggtcactgat |
45212622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University