View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9595A_low_150 (Length: 268)

Name: NF9595A_low_150
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9595A_low_150
NF9595A_low_150
[»] chr7 (4 HSPs)
chr7 (1-206)||(8348795-8349002)
chr7 (37-217)||(8354820-8355000)
chr7 (26-195)||(8410525-8410706)
chr7 (178-255)||(8361410-8361487)
[»] chr3 (1 HSPs)
chr3 (188-223)||(30938593-30938628)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 8349002 - 8348795
Alignment:
1 agagtttgcatccactgcaagaagggaaaggtataaatttcttggctagtctagagctttgctagttttggatggtttttacttattattgcctactaca 100  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
8349002 agagtttgcatccactacaagaagggaaaggtataaatttcttggctagtctacagctttgctagttttggatggtttttacttattattgcctactaca 8348903  T
101 ca--ttctcttaattaagctatagtttttaatatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgact 198  Q
    ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8348902 cacattctcttaattaagctatagtttttaatatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgact 8348803  T
199 tttagaag 206  Q
    ||||||||    
8348802 tttagaag 8348795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 37 - 217
Target Start/End: Complemental strand, 8355000 - 8354820
Alignment:
37 atttcttggctagtctagagctttgctagttttggatggtttttacttattattgcctactacacattctcttaattaagctatagtttttaatatttga 136  Q
    |||||||||||| || | || |||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
8355000 atttcttggctactcaatagttttgctagttttggctggtttttacttattattgcttactacacattctcttaactaagctatagtttttaatatttga 8354901  T
137 tttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgacttttagaagtaggttacttt 217  Q
    |||||||||||||||||| |||||||||||| ||||| |||| |||||  ||||||||| |||||||| | ||||||||||    
8354900 tttgtgagcttatagctccgcatagagaaagaaaattgctggtttttggaatggaattggcttttagaggaaggttacttt 8354820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 26 - 195
Target Start/End: Complemental strand, 8410706 - 8410525
Alignment:
26 gaaaggtataaatttcttggctagtctagagctttgctagttttggatggtttttacttatta-------ttgccta------ctacacattctcttaat 112  Q
    |||||||||  |||||||||||| |||| | ||||||||||||||| ||||||||||||||||       |||||||      |||||||||||||||||    
8410706 gaaaggtatctatttcttggctactctataactttgctagttttggctggtttttacttattaattattattgcctatagctactacacattctcttaat 8410607  T
113 taagctatagtttttaatatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattg 195  Q
    |||| ||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| |||| ||| | ||||||||||    
8410606 taagatatagtttttaatgtttgatttgtgagc-tatagctctgcatagagaaagcgaattgctggatttgggtatggaattg 8410525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 178 - 255
Target Start/End: Complemental strand, 8361487 - 8361410
Alignment:
178 ggttttgctatggaattgacttttagaagtaggttacttttctatgtcttgtccttacaggtgcaactttccctattt 255  Q
    ||||||| |||||| ||| |||||||| ||||||| | ||||||||||||||||||| | |||||||||||| |||||    
8361487 ggttttggtatggagttggcttttagatgtaggtttcctttctatgtcttgtccttatatgtgcaactttccatattt 8361410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 188 - 223
Target Start/End: Complemental strand, 30938628 - 30938593
Alignment:
188 tggaattgacttttagaagtaggttacttttctatg 223  Q
    ||||||||||||||||| ||||||||||||||||||    
30938628 tggaattgacttttagaggtaggttacttttctatg 30938593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University