View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_176 (Length: 250)
Name: NF9595A_low_176
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_176 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 242
Target Start/End: Original strand, 2890863 - 2891092
Alignment:
| Q |
12 |
tgttgattctaggccggaaacattttcacaaccaataaatgtttccggaatggacgaggttcaaggggaatgagagttggatgatcttgttaatgatttg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2890863 |
tgttgattctaggccggaaacattttcacaaccaataaatgttgccggaatggatgaggttcaaggggaatgggagttggatgatcttgttaatgatttg |
2890962 |
T |
|
| Q |
112 |
cacaaagaatggagtcaacatgaagggaagaagacagtgtcacaaaagtctgttgaatttatgttgaacaacaaagttagcatggtaaatggggaggann |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
2890963 |
cacaaagaatggagtcaacatgaagggaagaaggcagtgtcacaaaaatatgttgaatttatgttgaacaacaaagctagcatggtaaacggggagga-t |
2891061 |
T |
|
| Q |
212 |
nnnnnnacagtgcagctatcccccgtgttac |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2891062 |
ttttttacagtgcagctatcccccgtgttac |
2891092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 132
Target Start/End: Original strand, 14972688 - 14972756
Alignment:
| Q |
64 |
gacgaggttcaaggggaatgagagttggatgatcttgttaatgatttgcacaaagaatggagtcaacat |
132 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||| || |||||| |||||||||| ||| ||||||| |
|
|
| T |
14972688 |
gacgaggttcaaggggagtgggagttagatgatctagtgaatgatctgcacaaagagtggtctcaacat |
14972756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 67 - 143
Target Start/End: Original strand, 13059819 - 13059895
Alignment:
| Q |
67 |
gaggttcaaggggaatgagagttggatgatcttgttaatgatttgcacaaagaatggagtcaacatgaagggaagaa |
143 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||| |||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
13059819 |
gaggttcaaggggaatgggaattggatgaccttgttcatgatttgcaaaatgaatggagtcaacatgaagggaagaa |
13059895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 62 - 144
Target Start/End: Complemental strand, 48783604 - 48783522
Alignment:
| Q |
62 |
tggacgaggttcaaggggaatgagagttggatgatcttgttaatgatttgcacaaagaatggagtcaacatgaagggaagaag |
144 |
Q |
| |
|
|||| ||||| |||||||| || ||||||||||||||||| ||||||||||| || || |||| | ||||||||||||||| |
|
|
| T |
48783604 |
tggaggaggtccaaggggagtgggagttggatgatcttgtgaatgatttgcataaggagtggaatgttcatgaagggaagaag |
48783522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 142
Target Start/End: Complemental strand, 12964794 - 12964671
Alignment:
| Q |
19 |
tctaggccggaaacattttcacaaccaataaatgtttccggaatggacgaggttcaaggggaatgagagttggatgatcttgttaatgatttgcacaaag |
118 |
Q |
| |
|
|||||||||||| |||| |||| ||||| ||| ||| |||||| ||||||||||| ||||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
12964794 |
tctaggccggaagcattatcactaccaaatgatgaagccgaaatggatgaggttcaaggtgaatgggaattggatgctctagttaatgatttgcacaaag |
12964695 |
T |
|
| Q |
119 |
aatggagtcaacatgaagggaaga |
142 |
Q |
| |
|
| ||||| ||||||||||| |||| |
|
|
| T |
12964694 |
agtggagccaacatgaaggaaaga |
12964671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 126
Target Start/End: Complemental strand, 32520987 - 32520923
Alignment:
| Q |
62 |
tggacgaggttcaaggggaatgagagttggatgatcttgttaatgatttgcacaaagaatggagt |
126 |
Q |
| |
|
|||| ||||||||||||||||| || ||||||||| | || ||||||||||| || ||||||||| |
|
|
| T |
32520987 |
tggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagt |
32520923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 132
Target Start/End: Complemental strand, 45721300 - 45721232
Alignment:
| Q |
64 |
gacgaggttcaaggggaatgagagttggatgatcttgttaatgatttgcacaaagaatggagtcaacat |
132 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||| || |||||| |||||||||| ||| ||||||| |
|
|
| T |
45721300 |
gacgaggttcaaggggagtgggagttagatgatctagtgaatgatctgcacaaagagtggtctcaacat |
45721232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University