View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_183 (Length: 250)
Name: NF9595A_low_183
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_183 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 32103697 - 32103473
Alignment:
| Q |
14 |
ttttagatatgattaaatattgcagagaaatgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggcggctccatctccattaggcagtaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32103697 |
ttttagatatgattaaatattgcagagaaatgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggctgctccatctccattaggcagtaa |
32103598 |
T |
 |
| Q |
114 |
gcttcaaaacatgttgcaggctgcggtgcaatctgttcggtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttcttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103597 |
gcttcaaaacatgttgcaggctgcggtgcaatctgttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttcttt |
32103498 |
T |
 |
| Q |
214 |
tcctcttcctcactcactatatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32103497 |
tcctcttcctcactcactatatatt |
32103473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University