View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_190 (Length: 248)
Name: NF9595A_low_190
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_190 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 28519037 - 28518944
Alignment:
| Q |
1 |
attgacttcatcttctgacagttttgcagcaaatgcgttgaagctctttgtgtagctatatacaatggactctttggcttcatgataactaagt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519037 |
attgacttcatcttctgacagttttgcagcaaatgcattgaagctctttgtgtagctatatacaatggactctttggcttcatgataactaagt |
28518944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 28518858 - 28518816
Alignment:
| Q |
181 |
tgcttgattgaattaataaggttaccttcccttcacagaagat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28518858 |
tgcttgattgaattaataaggttaccttcccttcacagaagat |
28518816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 6 - 82
Target Start/End: Original strand, 12728877 - 12728953
Alignment:
| Q |
6 |
cttcatcttctgacagttttgcagcaaatgcgttgaagctctttgtgtagctatatacaatggactctttggcttca |
82 |
Q |
| |
|
||||||| || || ||||| ||||||||||| || ||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
12728877 |
cttcatcctcggatagtttagcagcaaatgcattaaagctctttgtgtagctgtatactatggactctttggcttca |
12728953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 6 - 82
Target Start/End: Complemental strand, 34291220 - 34291144
Alignment:
| Q |
6 |
cttcatcttctgacagttttgcagcaaatgcgttgaagctctttgtgtagctatatacaatggactctttggcttca |
82 |
Q |
| |
|
||||||| || |||||||| ||||||||||| || ||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
34291220 |
cttcatcctcagacagtttagcagcaaatgcattaaagctctttgtgtagctgtatactatggattctttggcttca |
34291144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University