View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_216 (Length: 244)
Name: NF9595A_low_216
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_216 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 34 - 239
Target Start/End: Original strand, 38932037 - 38932242
Alignment:
| Q |
34 |
tatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtttatcggaagtg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38932037 |
tatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtttattggaagtg |
38932136 |
T |
 |
| Q |
134 |
tcgaggagagtgacaataataagcggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataaggtcaccctgtttcacataac |
233 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932137 |
tcgaggagagtgacaataataagaggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataaggtcaccctgtttcacataac |
38932236 |
T |
 |
| Q |
234 |
gaacct |
239 |
Q |
| |
|
|||||| |
|
|
| T |
38932237 |
gaacct |
38932242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University