View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9595A_low_217 (Length: 244)
Name: NF9595A_low_217
Description: NF9595A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9595A_low_217 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 244
Target Start/End: Original strand, 36162890 - 36163113
Alignment:
| Q |
22 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaaacctcttgctgtccnnnnnnn-atccgtcttactgcatttaagttga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36162890 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaagcctcttgctgtccttttttttatccgtcttactgcattaaagttga |
36162989 |
T |
|
| Q |
121 |
ttaagactggccttgtatttttactaaactatctgtcttgagttcttgacaattggatgtgccttgtatttttacacgcttgttaattttgccctatttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36162990 |
ttaagactggccttgtatttttactaaactatctgacttgagttcttgacaattggatgtgccttgtatttttacacgcttgttaattttgccctatttt |
36163089 |
T |
|
| Q |
221 |
aaactatgctgtggtataactatg |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36163090 |
aaactatgctgtggtataactatg |
36163113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University